Introduction

Diversity Analyzer is a tool for annotation and diversity analysis of full-length adaptive immune repertoires (antibodies or TCRs). Diversity Analyzer is launched as a final step of IgReC. It is also available as a stand alone tool.

Input

Diversity Analyzer takes full-length immune sequences in FASTA/FASTQ format as an input. The tool expects that input sequences cover entire variable regions of antibody or TCR: from the start of V segment to the end of J segment. The tool is able to process raw Rep-seq libraries, as well as constructed repertoires.

Output

Diversity Analyzer performs V / J, CDR, and SHM labelings of input sequences; computes their diversity characteristics; computes nucleotide and amino acid substitutions; visualizes computed statistics and reports summary in user-friendly HTML format.

Output details

  1. Summary report
  2. VJ labeling output
  3. CDR labeling output
  4. SHM labeling output
  5. Diversity statistics
  6. Nucleotide and amino acid substitutions
  7. Summary annotation report

1. Summary report

Diversity Analyzer compiles a report in TSV format including basic diversity characteristics of input sequences. For each input sequence, report contains information about:

Example of summary diversity output can be found here.

2. VJ labeling output

Diversity Analyzer launches VJ Finder (ultra-fast aligner of Rep-seq reads) for finding V and J hits of input sequences. Based on computed VJ labeling, DiversityAnalyzer reports heatmap showing VJ usage:


Click for preview

2.1. V alignments

Diversity Analyzer reports all computed V alignments in FASTA file. Each alignment is presented as a pair of gapped sequences of equal length. Code below shows an example of V alignments in FASTA format for a single read-gene pair:

>INDEX:1|READ:1_merged_read|START_POS:0|END_POS:295 GAGGTGCAGTTGGTAGAGTCTGGGGGAGGATTGGTCCAGCCGGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGTTATTGGATGAGCTGGGTCC GCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGAAAGTGAGAAATATTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGC CAAGAAGTCACTGTCTCTGCGAACGAACAGGCTGAGAGCCGAGTACATGGCTGTGTATTACTGTGCGAGTAC
>INDEX:1|GENE:IGHV3-7*01|START_POS:0|END_POS:295|CHAIN_TYPE:IGH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCC GCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGC CAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA

3. CDR labeling output

Diversity Analyzer aligns input sequences against V and J segments from the IMGT database with known positions of CDRs (positions are consistent with IgBlast). Using alignment, positions of germline CDRs are converted into positions of input full-length sequences: cdr_computation IMGT and Kabat notations are available for labeling. Diversity Analyzer also reports computed CDR1s, CDR2s, and CDR3s in FASTA format.

3.1. CDR statistics

If a chain is presented by at least 100 input sequences, Diversity Analyzer computes characteristics of its CDRs:

Upper right: distribution of CDR3 lengths. Diversity Analyzer also selects length of CDR3s that presented by the largest number of CDR3s. For CDR3s of this length, nucleotide (lower left) and amino acid (lower right) content are visualized. Amino acids are colored according to their hydrophobicity. Hydrophobic amino acids are colored in red, hydrophilic amino acids are colored in blue, neutral amino acids are colored in pale colors.

4. SHM labeling output

For each input sequence, Diversity Analyzer computes SHMs and compiles their characteristics in TSV format. For each SHM, the following characteristics are reported:

Lines corresponding to SHMs from different sequences are separated by lines containing information about names of input sequence and germline gene, types of segment and chain. Example of SHM report for a single sequence is given below:


Click for preview

4.1 SHM plots

If a chain presented by at least 100 sequences, Diversity Analyzer reports plots for SHMs lying in V segments of sequences of this chain type:

IGH IGK IGL
Click for preview Click for preview Click for preview

Diversity Analyzer also reports statistics of special SHMs lying in V segments:

Distribution of indel SHMs positions Distribution of indel SHMs lengths Distribution of synonymous SHMs positions

Click for preview
Click for preview
Click for preview

5. Diversity statistics

For each computed CDR3, Diversity Analyzer computes its abundance as a number of input sequences with this CDR3. For a collection of CDR3 abundances, Diversity Analyzer applies methods of population analysis for computation of diversity characteristics of input sequences.

Simpson index (SI) Clonal Simpson index (CSI)
SI is computed as a probability of two randomly selected CDR3s to be equal. CSI is an approximation of a probability of two randomly selected CDR3s to belong to the same clonal lineage.

A ratio of CSI to SI demonstrates relation between clonally related receptor sequences to random sequences. The higher value of CSI / SI, the higher clonal diversity of an input dataset. Example of the comparative analysis of three datasets with various properties is given below:

PBMCs ASCs (negative to influenza HA) ASCs (positive to influenza HA)
0-th day of vaccination 7-th day of vaccination 7-th day of vaccination
SRR3620098 SRR3620075 SRR3620074
Low clonal diversity Medium clonal diversity High clonal diversity
CSI / SI = 1.36 CSI / SI = 7.15 CSI / SI = 11.96

6. Amino acid and nucleotide substitutions

Diversity Analyzer reports and visualizes matrices of nucleotide and amino acid substitutions:

Click for preview Click for preview

7. Summary annotation report

Diversity Analyzer compiles all computed statistics and plots into a single report in HTML format. Example of such report can be found here (antibody repertoire from HIV-infected patient, 181 week of disease).